ID: 1018420321

View in Genome Browser
Species Human (GRCh38)
Location 6:163635202-163635224
Sequence CAGGGAAATCTTCAGCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420321_1018420338 27 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420321_1018420336 25 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420336 6:163635250-163635272 GTTGGTGGCGGAGTGTTCTGGGG No data
1018420321_1018420331 7 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420331 6:163635232-163635254 TGGCTGTCGGGGGTCGGTGTTGG No data
1018420321_1018420335 24 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420335 6:163635249-163635271 TGTTGGTGGCGGAGTGTTCTGGG No data
1018420321_1018420334 23 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420334 6:163635248-163635270 GTGTTGGTGGCGGAGTGTTCTGG No data
1018420321_1018420337 26 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420337 6:163635251-163635273 TTGGTGGCGGAGTGTTCTGGGGG No data
1018420321_1018420329 -3 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420329 6:163635222-163635244 CTGGAACTGTTGGCTGTCGGGGG No data
1018420321_1018420333 13 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420333 6:163635238-163635260 TCGGGGGTCGGTGTTGGTGGCGG No data
1018420321_1018420324 -6 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420324 6:163635219-163635241 TCCCTGGAACTGTTGGCTGTCGG No data
1018420321_1018420328 -4 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420328 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
1018420321_1018420326 -5 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420326 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
1018420321_1018420332 10 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420321_1018420330 1 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420321 Original CRISPR CAGGGAAATCTTCAGCCTTC AGG (reversed) Intergenic
No off target data available for this crispr