ID: 1018420322

View in Genome Browser
Species Human (GRCh38)
Location 6:163635203-163635225
Sequence CTGAAGGCTGAAGATTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420317_1018420322 -4 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420322 6:163635203-163635225 CTGAAGGCTGAAGATTTCCCTGG No data
1018420315_1018420322 17 Left 1018420315 6:163635163-163635185 CCATGCTTTCAAACTCAAAGGCC No data
Right 1018420322 6:163635203-163635225 CTGAAGGCTGAAGATTTCCCTGG No data
1018420313_1018420322 26 Left 1018420313 6:163635154-163635176 CCTTCAAGGCCATGCTTTCAAAC No data
Right 1018420322 6:163635203-163635225 CTGAAGGCTGAAGATTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420322 Original CRISPR CTGAAGGCTGAAGATTTCCC TGG Intergenic