ID: 1018420323

View in Genome Browser
Species Human (GRCh38)
Location 6:163635212-163635234
Sequence GAAGATTTCCCTGGAACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420319_1018420323 -9 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420323 6:163635212-163635234 GAAGATTTCCCTGGAACTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 161
1018420315_1018420323 26 Left 1018420315 6:163635163-163635185 CCATGCTTTCAAACTCAAAGGCC No data
Right 1018420323 6:163635212-163635234 GAAGATTTCCCTGGAACTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 161
1018420317_1018420323 5 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420323 6:163635212-163635234 GAAGATTTCCCTGGAACTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420323 Original CRISPR GAAGATTTCCCTGGAACTGT TGG Intergenic