ID: 1018420325

View in Genome Browser
Species Human (GRCh38)
Location 6:163635220-163635242
Sequence CCCGACAGCCAACAGTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420325_1018420336 7 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420336 6:163635250-163635272 GTTGGTGGCGGAGTGTTCTGGGG No data
1018420325_1018420333 -5 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420333 6:163635238-163635260 TCGGGGGTCGGTGTTGGTGGCGG No data
1018420325_1018420337 8 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420337 6:163635251-163635273 TTGGTGGCGGAGTGTTCTGGGGG No data
1018420325_1018420338 9 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420325_1018420332 -8 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420325_1018420335 6 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420335 6:163635249-163635271 TGTTGGTGGCGGAGTGTTCTGGG No data
1018420325_1018420334 5 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420334 6:163635248-163635270 GTGTTGGTGGCGGAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420325 Original CRISPR CCCGACAGCCAACAGTTCCA GGG (reversed) Intergenic
No off target data available for this crispr