ID: 1018420327

View in Genome Browser
Species Human (GRCh38)
Location 6:163635221-163635243
Sequence CCCCGACAGCCAACAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420327_1018420335 5 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420335 6:163635249-163635271 TGTTGGTGGCGGAGTGTTCTGGG No data
1018420327_1018420336 6 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420336 6:163635250-163635272 GTTGGTGGCGGAGTGTTCTGGGG No data
1018420327_1018420334 4 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420334 6:163635248-163635270 GTGTTGGTGGCGGAGTGTTCTGG No data
1018420327_1018420337 7 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420337 6:163635251-163635273 TTGGTGGCGGAGTGTTCTGGGGG No data
1018420327_1018420333 -6 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420333 6:163635238-163635260 TCGGGGGTCGGTGTTGGTGGCGG No data
1018420327_1018420338 8 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420327_1018420332 -9 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420327 Original CRISPR CCCCGACAGCCAACAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr