ID: 1018420330

View in Genome Browser
Species Human (GRCh38)
Location 6:163635226-163635248
Sequence AACTGTTGGCTGTCGGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420320_1018420330 2 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data
1018420317_1018420330 19 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data
1018420319_1018420330 5 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data
1018420321_1018420330 1 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420330 6:163635226-163635248 AACTGTTGGCTGTCGGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420330 Original CRISPR AACTGTTGGCTGTCGGGGGT CGG Intergenic
No off target data available for this crispr