ID: 1018420332

View in Genome Browser
Species Human (GRCh38)
Location 6:163635235-163635257
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420327_1018420332 -9 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420319_1018420332 14 Left 1018420319 6:163635198-163635220 CCTCCCTGAAGGCTGAAGATTTC No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420320_1018420332 11 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420321_1018420332 10 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420325_1018420332 -8 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data
1018420317_1018420332 28 Left 1018420317 6:163635184-163635206 CCAAGGAGTGTGTGCCTCCCTGA No data
Right 1018420332 6:163635235-163635257 CTGTCGGGGGTCGGTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420332 Original CRISPR CTGTCGGGGGTCGGTGTTGG TGG Intergenic