ID: 1018420338

View in Genome Browser
Species Human (GRCh38)
Location 6:163635252-163635274
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018420325_1018420338 9 Left 1018420325 6:163635220-163635242 CCCTGGAACTGTTGGCTGTCGGG No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420320_1018420338 28 Left 1018420320 6:163635201-163635223 CCCTGAAGGCTGAAGATTTCCCT No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420327_1018420338 8 Left 1018420327 6:163635221-163635243 CCTGGAACTGTTGGCTGTCGGGG No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data
1018420321_1018420338 27 Left 1018420321 6:163635202-163635224 CCTGAAGGCTGAAGATTTCCCTG No data
Right 1018420338 6:163635252-163635274 TGGTGGCGGAGTGTTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018420338 Original CRISPR TGGTGGCGGAGTGTTCTGGG GGG Intergenic