ID: 1018421509

View in Genome Browser
Species Human (GRCh38)
Location 6:163644222-163644244
Sequence GTGCCCTCCCTTGGAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018421509_1018421513 -1 Left 1018421509 6:163644222-163644244 CCTCACACTCCAAGGGAGGGCAC No data
Right 1018421513 6:163644244-163644266 CTGCAGGGTGTGTACACCAGTGG No data
1018421509_1018421514 0 Left 1018421509 6:163644222-163644244 CCTCACACTCCAAGGGAGGGCAC No data
Right 1018421514 6:163644245-163644267 TGCAGGGTGTGTACACCAGTGGG No data
1018421509_1018421515 13 Left 1018421509 6:163644222-163644244 CCTCACACTCCAAGGGAGGGCAC No data
Right 1018421515 6:163644258-163644280 CACCAGTGGGCAGACTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018421509 Original CRISPR GTGCCCTCCCTTGGAGTGTG AGG (reversed) Intergenic
No off target data available for this crispr