ID: 1018424947

View in Genome Browser
Species Human (GRCh38)
Location 6:163671619-163671641
Sequence CGTCCCCAAAGCTCCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018424947_1018424954 21 Left 1018424947 6:163671619-163671641 CCTGCGCGGGAGCTTTGGGGACG No data
Right 1018424954 6:163671663-163671685 CTTCCGTTTGCCTCTGGGACTGG No data
1018424947_1018424952 16 Left 1018424947 6:163671619-163671641 CCTGCGCGGGAGCTTTGGGGACG No data
Right 1018424952 6:163671658-163671680 GGCCTCTTCCGTTTGCCTCTGGG No data
1018424947_1018424951 15 Left 1018424947 6:163671619-163671641 CCTGCGCGGGAGCTTTGGGGACG No data
Right 1018424951 6:163671657-163671679 AGGCCTCTTCCGTTTGCCTCTGG No data
1018424947_1018424949 -5 Left 1018424947 6:163671619-163671641 CCTGCGCGGGAGCTTTGGGGACG No data
Right 1018424949 6:163671637-163671659 GGACGCACTTCTGGATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018424947 Original CRISPR CGTCCCCAAAGCTCCCGCGC AGG (reversed) Intergenic