ID: 1018425334

View in Genome Browser
Species Human (GRCh38)
Location 6:163674882-163674904
Sequence CAGAGTGAAGAGGGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018425329_1018425334 4 Left 1018425329 6:163674855-163674877 CCACATTTTGATCTGGTGAGTAA No data
Right 1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018425334 Original CRISPR CAGAGTGAAGAGGGGGAAGA TGG Intergenic
No off target data available for this crispr