ID: 1018425713 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:163678827-163678849 |
Sequence | TGCCACATAAAGATGGTAGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018425705_1018425713 | 22 | Left | 1018425705 | 6:163678782-163678804 | CCATACACCTAATATGGAAAAGT | No data | ||
Right | 1018425713 | 6:163678827-163678849 | TGCCACATAAAGATGGTAGTGGG | No data | ||||
1018425706_1018425713 | 15 | Left | 1018425706 | 6:163678789-163678811 | CCTAATATGGAAAAGTATGCAGG | No data | ||
Right | 1018425713 | 6:163678827-163678849 | TGCCACATAAAGATGGTAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018425713 | Original CRISPR | TGCCACATAAAGATGGTAGT GGG | Intergenic | ||
No off target data available for this crispr |