ID: 1018425713

View in Genome Browser
Species Human (GRCh38)
Location 6:163678827-163678849
Sequence TGCCACATAAAGATGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018425705_1018425713 22 Left 1018425705 6:163678782-163678804 CCATACACCTAATATGGAAAAGT No data
Right 1018425713 6:163678827-163678849 TGCCACATAAAGATGGTAGTGGG No data
1018425706_1018425713 15 Left 1018425706 6:163678789-163678811 CCTAATATGGAAAAGTATGCAGG No data
Right 1018425713 6:163678827-163678849 TGCCACATAAAGATGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018425713 Original CRISPR TGCCACATAAAGATGGTAGT GGG Intergenic
No off target data available for this crispr