ID: 1018428636

View in Genome Browser
Species Human (GRCh38)
Location 6:163705527-163705549
Sequence GAAACTATTTCCCCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018428636_1018428643 29 Left 1018428636 6:163705527-163705549 CCTGTGGGAGGGGAAATAGTTTC No data
Right 1018428643 6:163705579-163705601 CGTGGCCATCTTTAATCTATAGG No data
1018428636_1018428642 11 Left 1018428636 6:163705527-163705549 CCTGTGGGAGGGGAAATAGTTTC No data
Right 1018428642 6:163705561-163705583 GAAGCGCATCAAAGAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018428636 Original CRISPR GAAACTATTTCCCCTCCCAC AGG (reversed) Intergenic
No off target data available for this crispr