ID: 1018434994

View in Genome Browser
Species Human (GRCh38)
Location 6:163751533-163751555
Sequence TTTCCACGGGACCCAGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018434980_1018434994 28 Left 1018434980 6:163751482-163751504 CCCACCGTGGCAGCCAGGGATGT No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data
1018434985_1018434994 5 Left 1018434985 6:163751505-163751527 CCAGCCCTGGTCTCTGTTCTCCA No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data
1018434981_1018434994 27 Left 1018434981 6:163751483-163751505 CCACCGTGGCAGCCAGGGATGTC No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data
1018434982_1018434994 24 Left 1018434982 6:163751486-163751508 CCGTGGCAGCCAGGGATGTCCAG No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data
1018434984_1018434994 15 Left 1018434984 6:163751495-163751517 CCAGGGATGTCCAGCCCTGGTCT No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data
1018434989_1018434994 0 Left 1018434989 6:163751510-163751532 CCTGGTCTCTGTTCTCCAGGGCG No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data
1018434988_1018434994 1 Left 1018434988 6:163751509-163751531 CCCTGGTCTCTGTTCTCCAGGGC No data
Right 1018434994 6:163751533-163751555 TTTCCACGGGACCCAGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018434994 Original CRISPR TTTCCACGGGACCCAGGTGT CGG Intergenic
No off target data available for this crispr