ID: 1018441520

View in Genome Browser
Species Human (GRCh38)
Location 6:163818101-163818123
Sequence TCATTGCCACAATGAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018441517_1018441520 15 Left 1018441517 6:163818063-163818085 CCTATATTCAGAGTCCAAAGATT No data
Right 1018441520 6:163818101-163818123 TCATTGCCACAATGAAAATGTGG No data
1018441519_1018441520 1 Left 1018441519 6:163818077-163818099 CCAAAGATTTGCAGAAAAGGATG No data
Right 1018441520 6:163818101-163818123 TCATTGCCACAATGAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018441520 Original CRISPR TCATTGCCACAATGAAAATG TGG Intergenic
No off target data available for this crispr