ID: 1018444911

View in Genome Browser
Species Human (GRCh38)
Location 6:163847164-163847186
Sequence TAGCTCCTTAGCATTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018444911_1018444913 0 Left 1018444911 6:163847164-163847186 CCAAGACCAATGCTAAGGAGCTA No data
Right 1018444913 6:163847187-163847209 TTTCCTCTGTATTTTCTCCTAGG No data
1018444911_1018444917 24 Left 1018444911 6:163847164-163847186 CCAAGACCAATGCTAAGGAGCTA No data
Right 1018444917 6:163847211-163847233 GTTTTATGGTTTCAGCTCTTAGG No data
1018444911_1018444915 10 Left 1018444911 6:163847164-163847186 CCAAGACCAATGCTAAGGAGCTA No data
Right 1018444915 6:163847197-163847219 ATTTTCTCCTAGGAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018444911 Original CRISPR TAGCTCCTTAGCATTGGTCT TGG (reversed) Intergenic
No off target data available for this crispr