ID: 1018444912

View in Genome Browser
Species Human (GRCh38)
Location 6:163847170-163847192
Sequence AGGAAATAGCTCCTTAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018444912_1018444918 25 Left 1018444912 6:163847170-163847192 CCAATGCTAAGGAGCTATTTCCT No data
Right 1018444918 6:163847218-163847240 GGTTTCAGCTCTTAGGTTGAAGG No data
1018444912_1018444917 18 Left 1018444912 6:163847170-163847192 CCAATGCTAAGGAGCTATTTCCT No data
Right 1018444917 6:163847211-163847233 GTTTTATGGTTTCAGCTCTTAGG No data
1018444912_1018444915 4 Left 1018444912 6:163847170-163847192 CCAATGCTAAGGAGCTATTTCCT No data
Right 1018444915 6:163847197-163847219 ATTTTCTCCTAGGAGTTTTATGG No data
1018444912_1018444913 -6 Left 1018444912 6:163847170-163847192 CCAATGCTAAGGAGCTATTTCCT No data
Right 1018444913 6:163847187-163847209 TTTCCTCTGTATTTTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018444912 Original CRISPR AGGAAATAGCTCCTTAGCAT TGG (reversed) Intergenic
No off target data available for this crispr