ID: 1018444915

View in Genome Browser
Species Human (GRCh38)
Location 6:163847197-163847219
Sequence ATTTTCTCCTAGGAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018444911_1018444915 10 Left 1018444911 6:163847164-163847186 CCAAGACCAATGCTAAGGAGCTA No data
Right 1018444915 6:163847197-163847219 ATTTTCTCCTAGGAGTTTTATGG No data
1018444912_1018444915 4 Left 1018444912 6:163847170-163847192 CCAATGCTAAGGAGCTATTTCCT No data
Right 1018444915 6:163847197-163847219 ATTTTCTCCTAGGAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018444915 Original CRISPR ATTTTCTCCTAGGAGTTTTA TGG Intergenic
No off target data available for this crispr