ID: 1018456476

View in Genome Browser
Species Human (GRCh38)
Location 6:163958249-163958271
Sequence TAGGGTCATACAGTGCTTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018456470_1018456476 27 Left 1018456470 6:163958199-163958221 CCTATTTAATCAGGCCACTGTAA No data
Right 1018456476 6:163958249-163958271 TAGGGTCATACAGTGCTTACCGG No data
1018456472_1018456476 13 Left 1018456472 6:163958213-163958235 CCACTGTAAAACGTGGTACAAAA No data
Right 1018456476 6:163958249-163958271 TAGGGTCATACAGTGCTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018456476 Original CRISPR TAGGGTCATACAGTGCTTAC CGG Intergenic
No off target data available for this crispr