ID: 1018456727

View in Genome Browser
Species Human (GRCh38)
Location 6:163960258-163960280
Sequence CCAGATTCTTTGTCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018456725_1018456727 13 Left 1018456725 6:163960222-163960244 CCAGGGATTGATTGAACTGGGTC No data
Right 1018456727 6:163960258-163960280 CCAGATTCTTTGTCTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018456727 Original CRISPR CCAGATTCTTTGTCTCTGCA AGG Intergenic
No off target data available for this crispr