ID: 1018458124

View in Genome Browser
Species Human (GRCh38)
Location 6:163971241-163971263
Sequence CACCCAGCTGGTGGGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018458116_1018458124 27 Left 1018458116 6:163971191-163971213 CCTGTTACTGGCTATCACTTGAG No data
Right 1018458124 6:163971241-163971263 CACCCAGCTGGTGGGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018458124 Original CRISPR CACCCAGCTGGTGGGGACAC TGG Intergenic
No off target data available for this crispr