ID: 1018459480

View in Genome Browser
Species Human (GRCh38)
Location 6:163984397-163984419
Sequence GCACCCAGTGGACTACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018459476_1018459480 26 Left 1018459476 6:163984348-163984370 CCAAGGTGCAACACGTAGGTGTC No data
Right 1018459480 6:163984397-163984419 GCACCCAGTGGACTACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018459480 Original CRISPR GCACCCAGTGGACTACAAGC TGG Intergenic
No off target data available for this crispr