ID: 1018462849

View in Genome Browser
Species Human (GRCh38)
Location 6:164015566-164015588
Sequence CCTTGTCTTGCACTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018462842_1018462849 11 Left 1018462842 6:164015532-164015554 CCATAAACCACTTAACATATCAA No data
Right 1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG No data
1018462843_1018462849 4 Left 1018462843 6:164015539-164015561 CCACTTAACATATCAACCAATGT No data
Right 1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018462849 Original CRISPR CCTTGTCTTGCACTGTGTTG GGG Intergenic
No off target data available for this crispr