ID: 1018465002

View in Genome Browser
Species Human (GRCh38)
Location 6:164035823-164035845
Sequence TCCCAGAGCCACAGTGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018464995_1018465002 18 Left 1018464995 6:164035782-164035804 CCAGAAGAATTAAGGGCCAGGCC No data
Right 1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG No data
1018464997_1018465002 2 Left 1018464997 6:164035798-164035820 CCAGGCCTAGAAAGGTGAGCTGG No data
Right 1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG No data
1018464999_1018465002 -3 Left 1018464999 6:164035803-164035825 CCTAGAAAGGTGAGCTGGACTCC No data
Right 1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018465002 Original CRISPR TCCCAGAGCCACAGTGGTCA GGG Intergenic
No off target data available for this crispr