ID: 1018466148

View in Genome Browser
Species Human (GRCh38)
Location 6:164047479-164047501
Sequence CTCTGTTAGGGTAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018466140_1018466148 -9 Left 1018466140 6:164047465-164047487 CCCTCATGGAGAGCCTCTGTTAG 0: 6
1: 91
2: 1223
3: 1542
4: 1305
Right 1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG No data
1018466141_1018466148 -10 Left 1018466141 6:164047466-164047488 CCTCATGGAGAGCCTCTGTTAGG 0: 7
1: 85
2: 1243
3: 1661
4: 1439
Right 1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018466148 Original CRISPR CTCTGTTAGGGTAGGGTGGA AGG Intergenic
No off target data available for this crispr