ID: 1018473123

View in Genome Browser
Species Human (GRCh38)
Location 6:164113772-164113794
Sequence TTTGGCCAATGAAAGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018473120_1018473123 -10 Left 1018473120 6:164113759-164113781 CCCCTCTGTGCATTTTGGCCAAT No data
Right 1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG No data
1018473119_1018473123 -7 Left 1018473119 6:164113756-164113778 CCTCCCCTCTGTGCATTTTGGCC No data
Right 1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG No data
1018473115_1018473123 1 Left 1018473115 6:164113748-164113770 CCCTGGGCCCTCCCCTCTGTGCA No data
Right 1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG No data
1018473118_1018473123 -6 Left 1018473118 6:164113755-164113777 CCCTCCCCTCTGTGCATTTTGGC No data
Right 1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG No data
1018473116_1018473123 0 Left 1018473116 6:164113749-164113771 CCTGGGCCCTCCCCTCTGTGCAT No data
Right 1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG No data
1018473114_1018473123 6 Left 1018473114 6:164113743-164113765 CCATTCCCTGGGCCCTCCCCTCT No data
Right 1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018473123 Original CRISPR TTTGGCCAATGAAAGAACAA AGG Intergenic
No off target data available for this crispr