ID: 1018473981

View in Genome Browser
Species Human (GRCh38)
Location 6:164122361-164122383
Sequence GCATTTCCACACTTTGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018473981_1018473988 7 Left 1018473981 6:164122361-164122383 CCCGCCTCAAAGTGTGGAAATGC No data
Right 1018473988 6:164122391-164122413 AGGAGTGGAGTCACTTGGCCAGG No data
1018473981_1018473989 8 Left 1018473981 6:164122361-164122383 CCCGCCTCAAAGTGTGGAAATGC No data
Right 1018473989 6:164122392-164122414 GGAGTGGAGTCACTTGGCCAGGG No data
1018473981_1018473987 2 Left 1018473981 6:164122361-164122383 CCCGCCTCAAAGTGTGGAAATGC No data
Right 1018473987 6:164122386-164122408 GTCAAAGGAGTGGAGTCACTTGG No data
1018473981_1018473986 -8 Left 1018473981 6:164122361-164122383 CCCGCCTCAAAGTGTGGAAATGC No data
Right 1018473986 6:164122376-164122398 GGAAATGCAGGTCAAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018473981 Original CRISPR GCATTTCCACACTTTGAGGC GGG (reversed) Intergenic
No off target data available for this crispr