ID: 1018475074

View in Genome Browser
Species Human (GRCh38)
Location 6:164132449-164132471
Sequence CTGTATGCACATGGGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018475074_1018475077 8 Left 1018475074 6:164132449-164132471 CCTGGCTGCCCATGTGCATACAG No data
Right 1018475077 6:164132480-164132502 TTGTGTCATAAGAATTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018475074 Original CRISPR CTGTATGCACATGGGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr