ID: 1018477437

View in Genome Browser
Species Human (GRCh38)
Location 6:164157642-164157664
Sequence ATGGAGAAGGAAAACGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018477433_1018477437 4 Left 1018477433 6:164157615-164157637 CCAGGAGCAGCATGGCACAAGGA No data
Right 1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG No data
1018477430_1018477437 15 Left 1018477430 6:164157604-164157626 CCTACAGTGTTCCAGGAGCAGCA No data
Right 1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018477437 Original CRISPR ATGGAGAAGGAAAACGAGGC TGG Intergenic
No off target data available for this crispr