ID: 1018478574

View in Genome Browser
Species Human (GRCh38)
Location 6:164167758-164167780
Sequence ATACTTCTCCAGCACTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018478568_1018478574 12 Left 1018478568 6:164167723-164167745 CCTTTACAACAAAGCAAGATGGA No data
Right 1018478574 6:164167758-164167780 ATACTTCTCCAGCACTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018478574 Original CRISPR ATACTTCTCCAGCACTGCAT GGG Intergenic
No off target data available for this crispr