ID: 1018481995

View in Genome Browser
Species Human (GRCh38)
Location 6:164200297-164200319
Sequence CAGAAAACTGCATTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018481991_1018481995 3 Left 1018481991 6:164200271-164200293 CCGGAAATGACTAATAGTGAAAC No data
Right 1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018481995 Original CRISPR CAGAAAACTGCATTGGTGGA TGG Intergenic
No off target data available for this crispr