ID: 1018483360

View in Genome Browser
Species Human (GRCh38)
Location 6:164214331-164214353
Sequence CTGTGTGTGTGGAAGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018483357_1018483360 1 Left 1018483357 6:164214307-164214329 CCTGTGGAGTGTCTGCTGCAGAT No data
Right 1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG No data
1018483355_1018483360 9 Left 1018483355 6:164214299-164214321 CCTTTCCTCCTGTGGAGTGTCTG No data
Right 1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG No data
1018483353_1018483360 11 Left 1018483353 6:164214297-164214319 CCCCTTTCCTCCTGTGGAGTGTC No data
Right 1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG No data
1018483354_1018483360 10 Left 1018483354 6:164214298-164214320 CCCTTTCCTCCTGTGGAGTGTCT No data
Right 1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG No data
1018483351_1018483360 28 Left 1018483351 6:164214280-164214302 CCAATCGTTACATGCTTCCCCTT No data
Right 1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG No data
1018483356_1018483360 4 Left 1018483356 6:164214304-164214326 CCTCCTGTGGAGTGTCTGCTGCA No data
Right 1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018483360 Original CRISPR CTGTGTGTGTGGAAGGCAGT TGG Intergenic
No off target data available for this crispr