ID: 1018485936

View in Genome Browser
Species Human (GRCh38)
Location 6:164241220-164241242
Sequence CTTTATCAGCAGAATGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018485936_1018485941 21 Left 1018485936 6:164241220-164241242 CCACTTTCATTCTGCTGATAAAG No data
Right 1018485941 6:164241264-164241286 TTATAAAGACAGAGGTTTAATGG No data
1018485936_1018485940 13 Left 1018485936 6:164241220-164241242 CCACTTTCATTCTGCTGATAAAG No data
Right 1018485940 6:164241256-164241278 TGGATAATTTATAAAGACAGAGG No data
1018485936_1018485937 -7 Left 1018485936 6:164241220-164241242 CCACTTTCATTCTGCTGATAAAG No data
Right 1018485937 6:164241236-164241258 GATAAAGATATGCCCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018485936 Original CRISPR CTTTATCAGCAGAATGAAAG TGG (reversed) Intergenic
No off target data available for this crispr