ID: 1018486140

View in Genome Browser
Species Human (GRCh38)
Location 6:164242927-164242949
Sequence AGGAGTTTACGCAGCACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018486140_1018486143 -7 Left 1018486140 6:164242927-164242949 CCTCCCGTGCTGCGTAAACTCCT No data
Right 1018486143 6:164242943-164242965 AACTCCTCTCCCATTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018486140 Original CRISPR AGGAGTTTACGCAGCACGGG AGG (reversed) Intergenic
No off target data available for this crispr