ID: 1018489032

View in Genome Browser
Species Human (GRCh38)
Location 6:164272768-164272790
Sequence CTCAAGGCCCAGAGGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018489032_1018489037 4 Left 1018489032 6:164272768-164272790 CCTTGCTTCCTCTGGGCCTTGAG No data
Right 1018489037 6:164272795-164272817 CCAGGTATTCCCTTGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018489032 Original CRISPR CTCAAGGCCCAGAGGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr