ID: 1018494056

View in Genome Browser
Species Human (GRCh38)
Location 6:164329903-164329925
Sequence GTGGCTGTCCTGACTAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018494054_1018494056 -1 Left 1018494054 6:164329881-164329903 CCTTGAAACTAGGCTGGACTGTG No data
Right 1018494056 6:164329903-164329925 GTGGCTGTCCTGACTAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018494056 Original CRISPR GTGGCTGTCCTGACTAATAG AGG Intergenic
No off target data available for this crispr