ID: 1018503960

View in Genome Browser
Species Human (GRCh38)
Location 6:164443827-164443849
Sequence GGCCCACAGCAGCTACATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018503960_1018503966 23 Left 1018503960 6:164443827-164443849 CCCACATGTAGCTGCTGTGGGCC No data
Right 1018503966 6:164443873-164443895 GCAGCCCTTCAAGAGAGCATAGG No data
1018503960_1018503965 1 Left 1018503960 6:164443827-164443849 CCCACATGTAGCTGCTGTGGGCC No data
Right 1018503965 6:164443851-164443873 AGGTGCAGCACAGTGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018503960 Original CRISPR GGCCCACAGCAGCTACATGT GGG (reversed) Intergenic
No off target data available for this crispr