ID: 1018507049

View in Genome Browser
Species Human (GRCh38)
Location 6:164483067-164483089
Sequence CTAGGTCACACCGTTGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018507047_1018507049 -1 Left 1018507047 6:164483045-164483067 CCTTTGACTCTGTGTCTCACATC 0: 42
1: 189
2: 1550
3: 2051
4: 1669
Right 1018507049 6:164483067-164483089 CTAGGTCACACCGTTGCAATAGG No data
1018507046_1018507049 11 Left 1018507046 6:164483033-164483055 CCAAGATGATCTCCTTTGACTCT No data
Right 1018507049 6:164483067-164483089 CTAGGTCACACCGTTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018507049 Original CRISPR CTAGGTCACACCGTTGCAAT AGG Intergenic
No off target data available for this crispr