ID: 1018515830

View in Genome Browser
Species Human (GRCh38)
Location 6:164579238-164579260
Sequence GCACAGAGCAGAACCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018515827_1018515830 23 Left 1018515827 6:164579192-164579214 CCTGACTGTCTATTTCAACACAA No data
Right 1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018515830 Original CRISPR GCACAGAGCAGAACCCAAGC AGG Intergenic
No off target data available for this crispr