ID: 1018516718

View in Genome Browser
Species Human (GRCh38)
Location 6:164588561-164588583
Sequence GCCTTAACTCGCCTGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018516718_1018516722 -4 Left 1018516718 6:164588561-164588583 CCCTCACACAGGCGAGTTAAGGC No data
Right 1018516722 6:164588580-164588602 AGGCCAAGGCAGGACTTGCAAGG No data
1018516718_1018516725 12 Left 1018516718 6:164588561-164588583 CCCTCACACAGGCGAGTTAAGGC No data
Right 1018516725 6:164588596-164588618 TGCAAGGCTGTGATCAGGCATGG No data
1018516718_1018516724 7 Left 1018516718 6:164588561-164588583 CCCTCACACAGGCGAGTTAAGGC No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018516718 Original CRISPR GCCTTAACTCGCCTGTGTGA GGG (reversed) Intergenic