ID: 1018516724

View in Genome Browser
Species Human (GRCh38)
Location 6:164588591-164588613
Sequence GGACTTGCAAGGCTGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018516711_1018516724 30 Left 1018516711 6:164588538-164588560 CCACAGAAAAGTCTGTGCCCCCA No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data
1018516718_1018516724 7 Left 1018516718 6:164588561-164588583 CCCTCACACAGGCGAGTTAAGGC No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data
1018516719_1018516724 6 Left 1018516719 6:164588562-164588584 CCTCACACAGGCGAGTTAAGGCC No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data
1018516716_1018516724 10 Left 1018516716 6:164588558-164588580 CCACCCTCACACAGGCGAGTTAA No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data
1018516713_1018516724 13 Left 1018516713 6:164588555-164588577 CCCCCACCCTCACACAGGCGAGT No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data
1018516715_1018516724 11 Left 1018516715 6:164588557-164588579 CCCACCCTCACACAGGCGAGTTA No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data
1018516714_1018516724 12 Left 1018516714 6:164588556-164588578 CCCCACCCTCACACAGGCGAGTT No data
Right 1018516724 6:164588591-164588613 GGACTTGCAAGGCTGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018516724 Original CRISPR GGACTTGCAAGGCTGTGATC AGG Intergenic