ID: 1018517451

View in Genome Browser
Species Human (GRCh38)
Location 6:164601365-164601387
Sequence CCTCTGAGACACCAGTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018517451_1018517457 23 Left 1018517451 6:164601365-164601387 CCTCAATACTGGTGTCTCAGAGG No data
Right 1018517457 6:164601411-164601433 GCCTTGGAAAAGTGCCTGCTGGG No data
1018517451_1018517455 7 Left 1018517451 6:164601365-164601387 CCTCAATACTGGTGTCTCAGAGG No data
Right 1018517455 6:164601395-164601417 GAGGCTGATTCAGCAAGCCTTGG No data
1018517451_1018517456 22 Left 1018517451 6:164601365-164601387 CCTCAATACTGGTGTCTCAGAGG No data
Right 1018517456 6:164601410-164601432 AGCCTTGGAAAAGTGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018517451 Original CRISPR CCTCTGAGACACCAGTATTG AGG (reversed) Intergenic
No off target data available for this crispr