ID: 1018518009 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:164609375-164609397 |
| Sequence | CCTGATCAGCTTTTATTGCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018518005_1018518009 | 23 | Left | 1018518005 | 6:164609329-164609351 | CCTCCATGTTTATTACAGAACTA | No data | ||
| Right | 1018518009 | 6:164609375-164609397 | CCTGATCAGCTTTTATTGCCTGG | No data | ||||
| 1018518004_1018518009 | 26 | Left | 1018518004 | 6:164609326-164609348 | CCACCTCCATGTTTATTACAGAA | No data | ||
| Right | 1018518009 | 6:164609375-164609397 | CCTGATCAGCTTTTATTGCCTGG | No data | ||||
| 1018518006_1018518009 | 20 | Left | 1018518006 | 6:164609332-164609354 | CCATGTTTATTACAGAACTATGT | No data | ||
| Right | 1018518009 | 6:164609375-164609397 | CCTGATCAGCTTTTATTGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018518009 | Original CRISPR | CCTGATCAGCTTTTATTGCC TGG | Intergenic | ||
| No off target data available for this crispr | |||||