ID: 1018518009

View in Genome Browser
Species Human (GRCh38)
Location 6:164609375-164609397
Sequence CCTGATCAGCTTTTATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018518005_1018518009 23 Left 1018518005 6:164609329-164609351 CCTCCATGTTTATTACAGAACTA No data
Right 1018518009 6:164609375-164609397 CCTGATCAGCTTTTATTGCCTGG No data
1018518004_1018518009 26 Left 1018518004 6:164609326-164609348 CCACCTCCATGTTTATTACAGAA No data
Right 1018518009 6:164609375-164609397 CCTGATCAGCTTTTATTGCCTGG No data
1018518006_1018518009 20 Left 1018518006 6:164609332-164609354 CCATGTTTATTACAGAACTATGT No data
Right 1018518009 6:164609375-164609397 CCTGATCAGCTTTTATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018518009 Original CRISPR CCTGATCAGCTTTTATTGCC TGG Intergenic
No off target data available for this crispr