ID: 1018520221

View in Genome Browser
Species Human (GRCh38)
Location 6:164641097-164641119
Sequence ACTGCCACCAGTCTGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018520221_1018520225 11 Left 1018520221 6:164641097-164641119 CCATCAGACAGACTGGTGGCAGT No data
Right 1018520225 6:164641131-164641153 CACAGCTACCACCCCCATGCTGG No data
1018520221_1018520231 27 Left 1018520221 6:164641097-164641119 CCATCAGACAGACTGGTGGCAGT No data
Right 1018520231 6:164641147-164641169 ATGCTGGCAAATGTCACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018520221 Original CRISPR ACTGCCACCAGTCTGTCTGA TGG (reversed) Intergenic
No off target data available for this crispr