ID: 1018520225

View in Genome Browser
Species Human (GRCh38)
Location 6:164641131-164641153
Sequence CACAGCTACCACCCCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018520221_1018520225 11 Left 1018520221 6:164641097-164641119 CCATCAGACAGACTGGTGGCAGT No data
Right 1018520225 6:164641131-164641153 CACAGCTACCACCCCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018520225 Original CRISPR CACAGCTACCACCCCCATGC TGG Intergenic
No off target data available for this crispr