ID: 1018526171

View in Genome Browser
Species Human (GRCh38)
Location 6:164712031-164712053
Sequence CCTTATTTAAGAAGTCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018526168_1018526171 15 Left 1018526168 6:164711993-164712015 CCAGGGAGAATACAACAGAAAGA No data
Right 1018526171 6:164712031-164712053 CCTTATTTAAGAAGTCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018526171 Original CRISPR CCTTATTTAAGAAGTCTGTA GGG Intergenic
No off target data available for this crispr