ID: 1018527492

View in Genome Browser
Species Human (GRCh38)
Location 6:164729076-164729098
Sequence GCCTCAGTGAAGGCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527492_1018527498 4 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG No data
1018527492_1018527500 26 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG No data
1018527492_1018527495 -3 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527495 6:164729096-164729118 GGCACTGCCTAGTGGAGCTGTGG 0: 65
1: 140
2: 181
3: 209
4: 333
1018527492_1018527499 5 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG No data
1018527492_1018527502 30 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527502 6:164729129-164729151 ACTGTCCTCCAGACCCTGGATGG No data
1018527492_1018527496 -2 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527496 6:164729097-164729119 GCACTGCCTAGTGGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527492 Original CRISPR GCCTCAGTGAAGGCTCTGTG TGG (reversed) Intergenic