ID: 1018527493

View in Genome Browser
Species Human (GRCh38)
Location 6:164729086-164729108
Sequence ACTAGGCAGTGCCTCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527493_1018527502 20 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527502 6:164729129-164729151 ACTGTCCTCCAGACCCTGGATGG No data
1018527493_1018527500 16 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG No data
1018527493_1018527499 -5 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG No data
1018527493_1018527498 -6 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527493 Original CRISPR ACTAGGCAGTGCCTCAGTGA AGG (reversed) Intergenic