ID: 1018527493

View in Genome Browser
Species Human (GRCh38)
Location 6:164729086-164729108
Sequence ACTAGGCAGTGCCTCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527493_1018527502 20 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527502 6:164729129-164729151 ACTGTCCTCCAGACCCTGGATGG No data
1018527493_1018527498 -6 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 70
1: 1712
2: 2103
3: 1478
4: 1053
1018527493_1018527499 -5 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG 0: 42
1: 1749
2: 2157
3: 1421
4: 1020
1018527493_1018527500 16 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG 0: 11
1: 29
2: 65
3: 111
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527493 Original CRISPR ACTAGGCAGTGCCTCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr