ID: 1018527494 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:164729088-164729110 |
Sequence | TTCACTGAGGCACTGCCTAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018527490_1018527494 | -10 | Left | 1018527490 | 6:164729075-164729097 | CCCACACAGAGCCTTCACTGAGG | No data | ||
Right | 1018527494 | 6:164729088-164729110 | TTCACTGAGGCACTGCCTAGTGG | No data | ||||
1018527489_1018527494 | -9 | Left | 1018527489 | 6:164729074-164729096 | CCCCACACAGAGCCTTCACTGAG | No data | ||
Right | 1018527494 | 6:164729088-164729110 | TTCACTGAGGCACTGCCTAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018527494 | Original CRISPR | TTCACTGAGGCACTGCCTAG TGG | Intergenic | ||