ID: 1018527498

View in Genome Browser
Species Human (GRCh38)
Location 6:164729103-164729125
Sequence CCTAGTGGAGCTGTGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6416
Summary {0: 70, 1: 1712, 2: 2103, 3: 1478, 4: 1053}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527489_1018527498 6 Left 1018527489 6:164729074-164729096 CCCCACACAGAGCCTTCACTGAG No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 70
1: 1712
2: 2103
3: 1478
4: 1053
1018527490_1018527498 5 Left 1018527490 6:164729075-164729097 CCCACACAGAGCCTTCACTGAGG No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 70
1: 1712
2: 2103
3: 1478
4: 1053
1018527492_1018527498 4 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 70
1: 1712
2: 2103
3: 1478
4: 1053
1018527493_1018527498 -6 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527498 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 70
1: 1712
2: 2103
3: 1478
4: 1053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527498 Original CRISPR CCTAGTGGAGCTGTGGGAAG AGG Intergenic
Too many off-targets to display for this crispr